Human genetics

Results: 4851



#Item
801Transgene / Genetically modified mouse / Molecular genetics / Gene / Animal testing / Human Genome Project / Genetic engineering / Outline of genetics / Biology / Genetics / Molecular biology

Helping Scientists Solve the Mystery of Disease C ancer. AIDS. Alzheimer ’s, and heart

Add to Reading List

Source URL: www.ca-biomed.org

Language: English - Date: 2009-11-27 13:19:48
802Genomics / Acid fast bacilli / Corynebacterineae / Mycobacteria / Tuberculosis / Mycobacterium / Human genome / Ancient DNA / Full genome sequencing / Biology / Bacteria / Genetics

ARTICLE Received 24 Oct 2014 | Accepted 18 Feb 2015 | Published 7 Apr 2015 DOI: ncomms7717 OPEN

Add to Reading List

Source URL: www.nature.com

Language: English - Date: 2015-04-07 11:00:52
803Population genetics / Genomics / Human genetics / Genetics / Biology / Molecular genetics

Microsoft Word - CAMB550_Syllabus 2015.FINAL.docx

Add to Reading List

Source URL: www.med.upenn.edu

Language: English - Date: 2015-03-11 14:28:31
804Epigenetics / Genomics / Human genome / Model organism / Genetics / Biology / Genetic mapping

Microsoft Word - UPDATE_CAMB 630 syllabus 2010.doc

Add to Reading List

Source URL: www.med.upenn.edu

Language: English - Date: 2010-09-13 11:27:53
805Genomics / Population genetics / Human genetics / Quantitative trait locus / Admixture mapping / Human genome / Human evolution / Genome / Heredity / Biology / Genetics / Philosophy of biology

Microsoft Word - biol_422_syllabus_03docx

Add to Reading List

Source URL: www.med.upenn.edu

Language: English - Date: 2015-03-26 11:25:30
806Population genetics / Genetic genealogy / Molecular biology / 23andMe / Single-nucleotide polymorphism / Genetic association / Human genome / Quantitative trait locus / Haplotype / Genetics / Biology / Classical genetics

Genetic Discovery in the
 23andMe Participant Cohort David A. Hinds1, Carrie A.M. Northover1, Matthew H. McIntyre1, Catherine Wilson1, Karen E. Huber1, Aaron Kleinman1, Fah Sathirapongsasuti1, Robert K. Bell1, Emma Pi

Add to Reading List

Source URL: blog.23andme.com

Language: English - Date: 2014-10-10 12:34:23
807Genomics / Human genetics / Medical ethics / Medical genetics / Human genome / Gene / Genetic testing / Public health genomics / Biology / Genetics / Medicine

Genetic Support Network of Victoria th 9 Floor, South Building, Murdoch Childrens Research Institute Flemington Road, Parkville Vic 3052 Ph: (Fax: (

Add to Reading List

Source URL: www.gsnv.org.au

Language: English - Date: 2012-10-07 22:08:58
808Human evolution / DNA / Phylogenetics / Livestock / Yak / Mitochondrial DNA / Haplogroup / Bovinae / Zebu / Genetics / Biology / Bovines

splrsvra_data0640papers_DTPCover.vp

Add to Reading List

Source URL: www.case.edu

Language: English - Date: 2008-04-14 15:51:04
809GAL4/UAS system / Frum / Drosophila melanogaster / RNA interference / Fruitless / Neuron / Biology / Genetics / Mating

Developmental changes in human dopamine neurotransmission: cortical receptors and terminators

Add to Reading List

Source URL: www.biomedcentral.com

Language: English
810Biology / Human genome / ENCODE / Genome / Computational genomics / Bioinformatics / Genetics / Genomics

GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA

Add to Reading List

Source URL: bejerano.stanford.edu

Language: English - Date: 2014-10-09 03:02:55
UPDATE